Detail of EST/Unigene BE316777 |
Acc. | BE316777 |
Internal Acc. | NF067B03LF1F1025 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | RuBisCO large subunit-binding protein subunit beta, chloroplastic OS=Pisum sativum E-value=1e-57; Chaperonin 60 subunit beta 2, chloroplastic OS=Arabidopsis thaliana E-value=1e-54; Chaperonin 60 subunit beta 1, chloroplastic OS=Arabidopsis thaliana E-value=4e-54; RuBisCO large subunit-binding protein subunit beta, chloroplastic (Fragment) OS=Secale cereale E-value=3e-53; Chaperonin 60 subunit beta 3, chloroplastic OS=Arabidopsis thaliana E-value=1e-52; |
Length | 357 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | CTCTTGTTGCTGAACTTAAACTAATGTCAAAAGAGGTTGAGGATAGTGAATTGGCTGATG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820549 |
Trichome-related Gene from Literature | N/A |