Detail of EST/Unigene BE316783 |
Acc. | BE316783 |
Internal Acc. | NF067E12LF1F1087 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit V, chloroplastic OS=Arabidopsis thaliana E-value=1e-22; Photosystem I reaction center subunit V, chloroplastic OS=Spinacia oleracea E-value=2e-22; Photosystem I reaction center subunit V, chloroplastic OS=Hordeum vulgare E-value=9e-21; Photosystem I reaction center subunit V, chloroplastic OS=Tortula ruralis E-value=1e-10; |
Length | 434 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | AAATTAAACAGAATTTAATATAAAAAAAAGATTCATTTTCCATTGATCATATAAAAGCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842016 |
Trichome-related Gene from Literature | N/A |