Detail of EST/Unigene BE316945 |
Acc. | BE316945 |
Internal Acc. | NF061D10LF1F1078 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 1, chloroplastic OS=Pisum sativum E-value=2e-45; Oxygen-evolving enhancer protein 1, chloroplastic OS=Nicotiana tabacum E-value=9e-36; Oxygen-evolving enhancer protein 1, chloroplastic OS=Solanum tuberosum E-value=1e-34; Oxygen-evolving enhancer protein 1, chloroplastic OS=Solanum lycopersicum E-value=1e-34; Oxygen-evolving enhancer protein 1, chloroplastic OS=Helianthus annuus E-value=7e-34; |
Length | 358 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | CAGTTAACATAGGAGCAATGGCAGCCTCACTCCAAGCAGCTGCTACTCTCATGCAACCAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836789 |
Trichome-related Gene from Literature | N/A |