Detail of EST/Unigene BE317187 |
Acc. | BE317187 |
Internal Acc. | NF069H11LF1F1092 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Replication factor C subunit 4 OS=Homo sapiens E-value=2e-14; Probable replication factor C subunit 4 OS=Dictyostelium discoideum E-value=2e-14; Replication factor C subunit 4 OS=Mus musculus E-value=1e-13; Replication factor C subunit 2 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=3e-08; Replication factor C subunit 4 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=3e-07; |
Length | 323 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | AAATCATGAGCAGCCGAATAGTATACATCTGCAAAGAAGAAGGAATCTACCTTGATGCTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K10755 replication factor C subunit 2/4; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K10755 replication factor C subunit 2/4; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10755 replication factor C subunit 2/4 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838771 |
Trichome-related Gene from Literature | N/A |