Detail of EST/Unigene BE317366 |
Acc. | BE317366 |
Internal Acc. | NF065G09LF1F1068 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Leucine aminopeptidase 3, chloroplastic OS=Arabidopsis thaliana E-value=1e-33; Leucine aminopeptidase 2, chloroplastic OS=Arabidopsis thaliana E-value=5e-33; Leucine aminopeptidase 2, chloroplastic OS=Solanum lycopersicum E-value=7e-33; Leucine aminopeptidase 1 OS=Arabidopsis thaliana E-value=4e-31; Leucine aminopeptidase 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-28; |
Length | 494 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | CTTCTGCCATTGTTATTGCTTTCTCAAAATCTTCGTCTTCTTCTCTCTTTCTCACTTCGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829216 |
Trichome-related Gene from Literature | N/A |