| Detail of EST/Unigene BE317424 |
| Acc. | BE317424 |
| Internal Acc. | NF069B04LF1F1029 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit XI, chloroplastic OS=Cucumis sativus E-value=2e-11; Photosystem I reaction center subunit XI, chloroplastic OS=Spinacia oleracea E-value=8e-11; Photosystem I reaction center subunit XI, chloroplastic OS=Arabidopsis thaliana E-value=3e-10; Photosystem I reaction center subunit XI, chloroplastic OS=Hordeum vulgare E-value=8e-08; |
| Length | 206 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | CATGGCAGCTGCTTCTCCTATGGCAAGCCAACTCAAGTCCAGACTTCACTAGACCTTTGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 826892 |
| Trichome-related Gene from Literature | N/A |