| Detail of EST/Unigene BE317439 |
| Acc. | BE317439 |
| Internal Acc. | NF069E09LF1F1067 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Geranylgeranyl diphosphate reductase, chloroplastic OS=Arabidopsis thaliana E-value=4e-20; Geranylgeranyl diphosphate reductase, chloroplastic OS=Nicotiana tabacum E-value=6e-19; Geranylgeranyl diphosphate reductase, chloroplastic OS=Oryza sativa subsp. japonica E-value=7e-18; Geranylgeranyl diphosphate reductase OS=Synechocystis sp. (strain PCC 6803 / Kazusa) E-value=2e-13; |
| Length | 151 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | GAGAGAGAGAACTAGTCTCTCTCTCTCTTACTATGAGGATCTTGCGGAGATGTACGTGGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 843788 |
| Trichome-related Gene from Literature | N/A |