Detail of EST/Unigene BE317491 |
Acc. | BE317491 |
Internal Acc. | NF070E09LF1F1067 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=2e-61; Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=5e-61; Chlorophyll a-b binding protein 1, chloroplastic OS=Zea mays E-value=3e-56; Chlorophyll a-b binding protein of LHCII type I, chloroplastic (Fragment) OS=Cucumis sativus E-value=1e-55; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=4e-55; |
Length | 341 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | CAAGAATTGGGAGCTGCAAGGTTCACCATGAGGAAGGCTGCTACCACCAAGAAAGTAGCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818006 |
Trichome-related Gene from Literature | N/A |