Detail of EST/Unigene BE317530 |
Acc. | BE317530 |
Internal Acc. | NF051A11LF1F1081 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L9, chloroplastic OS=Pisum sativum E-value=4e-38; 50S ribosomal protein L9, chloroplastic OS=Arabidopsis thaliana E-value=3e-30; 50S ribosomal protein L9, chloroplastic OS=Ipomoea trifida E-value=1e-29; 50S ribosomal protein L9, chloroplastic OS=Triticum aestivum E-value=3e-25; 50S ribosomal protein L9 OS=Anabaena variabilis (strain ATCC 29413 / PCC 7937) E-value=4e-11; |
Length | 492 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | AGAACACAAATTGAGCGGTGAGTTAACAAAACAACAATGGCATCATCATCAACATTATCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 823623 |
Trichome-related Gene from Literature | N/A |