Detail of EST/Unigene BE317541 |
Acc. | BE317541 |
Internal Acc. | NF051B12LF1F1093 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Triticum aestivum E-value=6e-43; Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=2e-34; Glucan endo-1,3-beta-glucosidase 3 OS=Arabidopsis thaliana E-value=4e-21; Glucan endo-1,3-beta-glucosidase 13 OS=Arabidopsis thaliana E-value=8e-20; Glucan endo-1,3-beta-glucosidase 12 OS=Arabidopsis thaliana E-value=5e-19; |
Length | 594 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | CAGGGAGAGGCACGCCGTTGATGCCAAACAGGAGGTTTGAGACTTTTCTTTTTGCTTTGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824709 |
Trichome-related Gene from Literature | N/A |