Detail of EST/Unigene BE317552 |
Acc. | BE317552 |
Internal Acc. | NF051C12LF1F1086 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Phosphoribulokinase, chloroplastic OS=Triticum aestivum E-value=7e-67; Phosphoribulokinase, chloroplastic OS=Mesembryanthemum crystallinum E-value=2e-66; Phosphoribulokinase, chloroplastic OS=Arabidopsis thaliana E-value=2e-65; Phosphoribulokinase, chloroplastic OS=Spinacia oleracea E-value=9e-65; Phosphoribulokinase, chloroplastic OS=Chlamydomonas reinhardtii E-value=1e-54; |
Length | 447 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | AAAGTATCAAGGCTAGCATTGAAGCAAGGAAGCCTGATTTTGAAGCTTATATTGATCCAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 840098 |
Trichome-related Gene from Literature | N/A |