Detail of EST/Unigene BE317588 |
Acc. | BE317588 |
Internal Acc. | NF051H08LF1F1064 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Plastocyanin, chloroplastic OS=Pisum sativum E-value=2e-30; Plastocyanin, chloroplastic OS=Solanum lycopersicum E-value=8e-21; Plastocyanin A, chloroplastic OS=Populus nigra E-value=1e-20; Plastocyanin major isoform, chloroplastic OS=Arabidopsis thaliana E-value=1e-20; Plastocyanin B, chloroplastic OS=Populus nigra E-value=4e-20; |
Length | 351 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | AGAGACTAATTAATCATCTTGAGAGAAAATGGCCACCGTTACTTCCACCACCGTTGCTAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838622 |
Trichome-related Gene from Literature | N/A |