| Detail of EST/Unigene BE317717 |
| Acc. | BE317717 |
| Internal Acc. | NF054E01LF1F1003 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit psaK, chloroplastic OS=Medicago sativa E-value=2e-26; Photosystem I reaction center subunit psaK, chloroplastic OS=Arabidopsis thaliana E-value=8e-16; Photosystem I reaction center subunit psaK, chloroplastic OS=Hordeum vulgare E-value=3e-06; |
| Length | 189 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | GGCAACTTCTATGATGATAACTTTGCCTCAATTCACTGGTCTTAGATCACAACTCAAACC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839918 |
| Trichome-related Gene from Literature | N/A |