Detail of EST/Unigene BE317717 |
Acc. | BE317717 |
Internal Acc. | NF054E01LF1F1003 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit psaK, chloroplastic OS=Medicago sativa E-value=2e-26; Photosystem I reaction center subunit psaK, chloroplastic OS=Arabidopsis thaliana E-value=8e-16; Photosystem I reaction center subunit psaK, chloroplastic OS=Hordeum vulgare E-value=3e-06; |
Length | 189 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | GGCAACTTCTATGATGATAACTTTGCCTCAATTCACTGGTCTTAGATCACAACTCAAACC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839918 |
Trichome-related Gene from Literature | N/A |