Detail of EST/Unigene BE317720 |
Acc. | BE317720 |
Internal Acc. | NF054F03LF1F1027 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Malate dehydrogenase, cytoplasmic OS=Medicago sativa E-value=4e-12; Malate dehydrogenase, cytoplasmic 2 OS=Arabidopsis thaliana E-value=1e-10; Malate dehydrogenase, cytoplasmic 1 OS=Arabidopsis thaliana E-value=1e-10; Malate dehydrogenase, cytoplasmic OS=Oryza sativa subsp. japonica E-value=2e-10; Malate dehydrogenase, cytoplasmic OS=Zea mays E-value=2e-10; |
Length | 176 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | CTCTCTCAAACAAAAACTCTTGTTTCTCTTCTCATCAATCTTCCATTTTCGATTCCTTTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.1.1.37 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 834351 |
Trichome-related Gene from Literature | N/A |