Detail of EST/Unigene BE317765
Acc. BE317765
Internal Acc. NF052B11LF1F1089
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Photosystem I reaction center subunit III, chloroplastic OS=Flaveria trinervia E-value=1e-13; Photosystem I reaction center subunit III, chloroplastic OS=Spinacia oleracea E-value=9e-12; Photosystem I reaction center subunit III, chloroplastic OS=Hordeum vulgare E-value=1e-11; Photosystem I reaction center subunit III, chloroplastic OS=Arabidopsis thaliana E-value=4e-11; Photosystem I reaction center subunit III, chloroplastic OS=Chlamydomonas reinhardtii E-value=2e-08;
Length 111 nt
Species Medicago truncatula
Belonged EST Libraries MT_DLEAF;
Sequence CTCCGGACAGCGCTCCAGCGCTGGCCATAAAAGCAACAGTTGAGAAAACCAAGAGAAGGT
TTGATAACTATGGAAAGCAAGGTTTGTTGTGTGGTGCTGATGGATTACCAC
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 840021 
Trichome-related Gene from Literature N/A