| Detail of EST/Unigene BE317885 |
| Acc. | BE317885 |
| Internal Acc. | NF059G12LF1F1088 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ferredoxin-1, chloroplastic OS=Pisum sativum E-value=4e-57; Ferredoxin-1, chloroplastic OS=Mesembryanthemum crystallinum E-value=2e-40; Ferredoxin, chloroplastic OS=Capsicum annuum E-value=5e-39; Ferredoxin-1, chloroplastic OS=Arabidopsis thaliana E-value=6e-39; Ferredoxin-2, chloroplastic OS=Arabidopsis thaliana E-value=1e-38; |
| Length | 559 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAAAATTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 837639 |
| Trichome-related Gene from Literature | N/A |