Detail of EST/Unigene BE318004 |
Acc. | BE318004 |
Internal Acc. | NF061F10LF1F1079 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Carbonic anhydrase, chloroplastic OS=Pisum sativum E-value=7e-36; Carbonic anhydrase, chloroplastic OS=Arabidopsis thaliana E-value=2e-14; Carbonic anhydrase, chloroplastic OS=Nicotiana tabacum E-value=5e-11; Carbonic anhydrase, chloroplastic OS=Spinacia oleracea E-value=6e-11; Carbonic anhydrase OS=Flaveria pringlei E-value=3e-08; |
Length | 334 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | CGGCTTTAGTCTCTCTTCTTTGTCCCCTACAAAAACTTCTATTAAAAAAGTTACATTGAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821134 |
Trichome-related Gene from Literature | N/A |