Detail of EST/Unigene BE318060 |
Acc. | BE318060 |
Internal Acc. | NF062A09LF1F1065 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Translation factor GUF1 homolog, chloroplastic OS=Ricinus communis E-value=5e-64; Translation factor GUF1 homolog, chloroplastic OS=Populus trichocarpa E-value=8e-64; Translation factor GUF1 homolog, chloroplastic OS=Vitis vinifera E-value=7e-63; Translation factor GUF1 homolog, chloroplastic OS=Arabidopsis thaliana E-value=3e-62; Translation factor GUF1 homolog, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-61; |
Length | 399 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | GGAACAGTTTCTTGATAATATGGATTTAGAGAGAGAAAGAGGCATCACTATTAAGCTTCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.6.5.3 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830766 |
Trichome-related Gene from Literature | N/A |