Detail of EST/Unigene BE318071 |
Acc. | BE318071 |
Internal Acc. | NF062C03LF1F1018 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 215, chloroplastic OS=Pisum sativum E-value=3e-25; Chlorophyll a-b binding protein, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-24; Chlorophyll a-b binding protein, chloroplastic OS=Oryza sativa subsp. indica E-value=2e-24; Chlorophyll a-b binding protein type 2 member 2 (Fragment) OS=Pinus sylvestris E-value=3e-24; Chlorophyll a-b binding protein type I, chloroplastic OS=Pinus thunbergii E-value=3e-24; |
Length | 330 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | CAAGAGTTGACATTTCTTGGGATCCATATTTCTAACATATAATCAGCCACATACAGGTTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822391 |
Trichome-related Gene from Literature | N/A |