| Detail of EST/Unigene BE318207 |
| Acc. | BE318207 |
| Internal Acc. | NF036F05LF1F1044 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Lycopene epsilon cyclase, chloroplastic OS=Arabidopsis thaliana E-value=4e-45; Lycopene epsilon cyclase, chloroplastic OS=Solanum lycopersicum E-value=9e-44; Lycopene beta cyclase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=8e-11; Lycopene beta cyclase, chloroplastic OS=Solanum lycopersicum E-value=4e-10; Lycopene beta cyclase, chloroplastic/chromoplastic OS=Narcissus pseudonarcissus E-value=1e-09; |
| Length | 341 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | GTGTCTCATATCTTGGCTCAAAAGTAGAAAGGATTGTTGAGGCTAGCAATGGTCATAATC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 835806 |
| Trichome-related Gene from Literature | N/A |