Detail of EST/Unigene BE318207 |
Acc. | BE318207 |
Internal Acc. | NF036F05LF1F1044 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Lycopene epsilon cyclase, chloroplastic OS=Arabidopsis thaliana E-value=4e-45; Lycopene epsilon cyclase, chloroplastic OS=Solanum lycopersicum E-value=9e-44; Lycopene beta cyclase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=8e-11; Lycopene beta cyclase, chloroplastic OS=Solanum lycopersicum E-value=4e-10; Lycopene beta cyclase, chloroplastic/chromoplastic OS=Narcissus pseudonarcissus E-value=1e-09; |
Length | 341 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | GTGTCTCATATCTTGGCTCAAAAGTAGAAAGGATTGTTGAGGCTAGCAATGGTCATAATC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835806 |
Trichome-related Gene from Literature | N/A |