Detail of EST/Unigene BE318216 |
Acc. | BE318216 |
Internal Acc. | NF036F11LF1F1092 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | unknown |
Length | 596 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | TGAAGATGGGGCTAGCAACAGCAAGAGCAACTGTAAGCATTTGTGGTGCTGCTGCTGCTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00627 1,4-Dichlorobenzene degradation > K01061 carboxymethylenebutenolidase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00364 Fluorobenzoate degradation > K01061 carboxymethylenebutenolidase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00361 gamma-Hexachlorocyclohexane degradation > K01061 carboxymethylenebutenolidase |
EC | 3.1.1.45 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 840434 |
Trichome-related Gene from Literature | N/A |