| Detail of EST/Unigene BE318235 |
| Acc. | BE318235 |
| Internal Acc. | NF036H09LF1F1077 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein CP29.3, chloroplastic OS=Arabidopsis thaliana E-value=5e-53; Chlorophyll a-b binding protein CP29.1, chloroplastic OS=Arabidopsis thaliana E-value=2e-48; Chlorophyll a-b binding protein CP29.2, chloroplastic OS=Arabidopsis thaliana E-value=9e-47; Chlorophyll a-b binding protein CP29 OS=Chlamydomonas reinhardtii E-value=1e-29; Chlorophyll a-b binding protein, chloroplastic OS=Petunia hybrida E-value=3e-09; |
| Length | 345 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | ATGGGCTAGTGTGGTTTCCTGGTGCTCAGCCACCGGAATGGCTCGATGGGACGATGATCG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818599 |
| Trichome-related Gene from Literature | N/A |