Detail of EST/Unigene BE318543 |
Acc. | BE318543 |
Internal Acc. | NF040D08LF1F1063 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Pyruvate kinase isozyme A, chloroplastic OS=Ricinus communis E-value=3e-15; Plastidial pyruvate kinase 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-14; Pyruvate kinase isozyme A, chloroplastic OS=Nicotiana tabacum E-value=1e-14; Pyruvate kinase isozyme G, chloroplastic OS=Nicotiana tabacum E-value=3e-06; |
Length | 409 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | TCTGATAAATCAACAAGAAGTGGTACAACACCCCATTGCAAATTCAGAGCCATTCGAGTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821870 |
Trichome-related Gene from Literature | N/A |