| Detail of EST/Unigene BE318543 |
| Acc. | BE318543 |
| Internal Acc. | NF040D08LF1F1063 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Pyruvate kinase isozyme A, chloroplastic OS=Ricinus communis E-value=3e-15; Plastidial pyruvate kinase 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-14; Pyruvate kinase isozyme A, chloroplastic OS=Nicotiana tabacum E-value=1e-14; Pyruvate kinase isozyme G, chloroplastic OS=Nicotiana tabacum E-value=3e-06; |
| Length | 409 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | TCTGATAAATCAACAAGAAGTGGTACAACACCCCATTGCAAATTCAGAGCCATTCGAGTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 821870 |
| Trichome-related Gene from Literature | N/A |