| Detail of EST/Unigene BE318616 |
| Acc. | BE318616 |
| Internal Acc. | NF042C09LF1F1067 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L12, chloroplastic OS=Nicotiana tabacum E-value=6e-18; 50S ribosomal protein L12-3, chloroplastic OS=Arabidopsis thaliana E-value=4e-17; 50S ribosomal protein L12, chloroplastic OS=Nicotiana sylvestris E-value=9e-17; 50S ribosomal protein L12-1, chloroplastic OS=Arabidopsis thaliana E-value=2e-16; 50S ribosomal protein L12, chloroplastic OS=Spinacia oleracea E-value=2e-16; |
| Length | 447 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | CTTCAATTCAATTCTCTAACAACAATGGCATTATCAACAACCGCTTTCACAACTATCTCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822405 |
| Trichome-related Gene from Literature | N/A |