Detail of EST/Unigene BE318687 |
Acc. | BE318687 |
Internal Acc. | NF041C11LF1F1083 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Delta-aminolevulinic acid dehydratase, chloroplastic (Fragment) OS=Pisum sativum E-value=3e-40; Delta-aminolevulinic acid dehydratase, chloroplastic OS=Glycine max E-value=1e-32; Delta-aminolevulinic acid dehydratase, chloroplastic OS=Spinacia oleracea E-value=8e-24; Delta-aminolevulinic acid dehydratase, chloroplastic OS=Arabidopsis thaliana E-value=3e-23; Delta-aminolevulinic acid dehydratase, chloroplastic OS=Selaginella martensii E-value=5e-21; |
Length | 505 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | CCTTCTTTCACATTTCCACGCCTCATTCTCCGATCTCAATCATCAATTATGGCTTCTTCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843310 |
Trichome-related Gene from Literature | N/A |