| Detail of EST/Unigene BE318731 |
| Acc. | BE318731 |
| Internal Acc. | NF042F12LF1F1096 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein 2, chloroplastic OS=Spinacia oleracea E-value=1e-52; 33 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=4e-23; 28 kDa ribonucleoprotein, chloroplastic OS=Spinacia oleracea E-value=4e-21; 31 kDa ribonucleoprotein, chloroplastic OS=Nicotiana plumbaginifolia E-value=3e-20; 29 kDa ribonucleoprotein A, chloroplastic OS=Nicotiana sylvestris E-value=3e-20; |
| Length | 674 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | CTCAAAACAAAACAAAACCACCATTTCCAGTTACTTCTTCATTCAATCCTCAATTCTTCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824379 |
| Trichome-related Gene from Literature | N/A |