| Detail of EST/Unigene BE318824 |
| Acc. | BE318824 |
| Internal Acc. | NF003F01LF1F1012 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 1, chloroplastic OS=Pisum sativum E-value=3e-61; Oxygen-evolving enhancer protein 1, chloroplastic OS=Nicotiana tabacum E-value=6e-48; Oxygen-evolving enhancer protein 1, chloroplastic OS=Solanum tuberosum E-value=1e-47; Oxygen-evolving enhancer protein 1, chloroplastic OS=Solanum lycopersicum E-value=1e-46; Oxygen-evolving enhancer protein 1, chloroplastic OS=Helianthus annuus E-value=2e-43; |
| Length | 396 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | CCTCACTCCAAGCAGCTGCTACTCTCATGCAACCAACCAAGTTACGTAGCAACAGTTTGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 836789 |
| Trichome-related Gene from Literature | N/A |