Detail of EST/Unigene BE318879 |
Acc. | BE318879 |
Internal Acc. | NF003D11LF1F1091 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 215, chloroplastic OS=Pisum sativum E-value=4e-99; Chlorophyll a-b binding protein 37, chloroplastic OS=Petunia sp. E-value=4e-88; Chlorophyll a-b binding protein 36, chloroplastic OS=Nicotiana tabacum E-value=5e-87; Chlorophyll a-b binding protein of LHCII type I, chloroplastic OS=Lemna gibba E-value=8e-85; Chlorophyll a-b binding protein, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-80; |
Length | 623 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | AAACCTCAACGCCCTCATGGCCACCTCTGCAATCCAACAATCAGCATTCACTGGAAAGAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 815058 |
Trichome-related Gene from Literature | N/A |