| Detail of EST/Unigene BE318925 |
| Acc. | BE318925 |
| Internal Acc. | NF004H09LF1F1077 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Microsomal glutathione S-transferase 3 OS=Bos taurus E-value=8e-23; Microsomal glutathione S-transferase 3 OS=Homo sapiens E-value=2e-22; Microsomal glutathione S-transferase 3 OS=Mus musculus E-value=1e-21; Microsomal glutathione S-transferase 2 OS=Bos taurus E-value=2e-07; Microsomal glutathione S-transferase 2 OS=Homo sapiens E-value=4e-07; |
| Length | 621 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | CCTCGTGCCGCTCGTTGAATCTTTCGTTCTTCAGAAAAAAACTAACAAGAAACAAACCAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
| EC | 2.5.1.18 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842893 |
| Trichome-related Gene from Literature | N/A |