| Detail of EST/Unigene BE319093 |
| Acc. | BE319093 |
| Internal Acc. | NF043G03LF1F1021 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein P4, chloroplastic OS=Pisum sativum E-value=2e-87; Chlorophyll a-b binding protein 4, chloroplastic OS=Arabidopsis thaliana E-value=3e-78; Chlorophyll a-b binding protein 1B-20, chloroplastic (Fragment) OS=Hordeum vulgare Ib-20 E-value=3e-44; Chlorophyll a-b binding protein, chloroplastic OS=Petunia hybrida E-value=1e-35; Chlorophyll a-b binding protein 7, chloroplastic OS=Solanum lycopersicum E-value=3e-34; |
| Length | 601 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | ATTTTCATCTTCATTTTCAACCTTTATTTTTTCTTTGTCACTGCCACCGCTACTACTACC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 823901 |
| Trichome-related Gene from Literature | N/A |