Detail of EST/Unigene BE319129 |
Acc. | BE319129 |
Internal Acc. | NF044F11LF1F1092 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Plastocyanin, chloroplastic OS=Pisum sativum E-value=8e-61; Plastocyanin, chloroplastic OS=Solanum lycopersicum E-value=2e-47; Plastocyanin, chloroplastic OS=Silene pratensis E-value=2e-46; Plastocyanin, chloroplastic OS=Spinacia oleracea E-value=4e-46; Plastocyanin A, chloroplastic OS=Populus nigra E-value=8e-45; |
Length | 572 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | AATTAATCATCTTGAGAGAAAATGGCCACCGTTACTTCCACCACCGTTGCTATTCCATCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838622 |
Trichome-related Gene from Literature | N/A |