Detail of EST/Unigene BE319189 |
Acc. | BE319189 |
Internal Acc. | NF045F10LF1F1080 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein type 2 member 1B, chloroplastic OS=Pinus sylvestris E-value=2e-39; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=2e-39; Chlorophyll a-b binding protein C, chloroplastic OS=Nicotiana plumbaginifolia E-value=2e-39; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=2e-39; Chlorophyll a-b binding protein 1D (Fragment) OS=Solanum lycopersicum E-value=5e-39; |
Length | 431 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | TTACCGTATTGCTGGTGGACCTCTCGGTGAGGTGGTTGACCCATCTCTACCCAGGTGGCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |