Detail of EST/Unigene BE319302 |
Acc. | BE319302 |
Internal Acc. | NF016A05RT1F1036 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Calcium-dependent protein kinase SK5 OS=Glycine max E-value=4e-82; Calcium-dependent protein kinase 4 OS=Arabidopsis thaliana E-value=1e-68; Calcium-dependent protein kinase 11 OS=Arabidopsis thaliana E-value=2e-68; Calcium-dependent protein kinase 12 OS=Arabidopsis thaliana E-value=2e-67; Calcium-dependent protein kinase 2 OS=Arabidopsis thaliana E-value=2e-62; |
Length | 546 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DROOT; |
Sequence | CGGAGGTCTTGCGCAAACTCTATGGACCTGAATCAGATGTGTGGAGTGCTGGAGTTATTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04020 Calcium signaling pathway > K04515 calcium/calmodulin-dependent protein kinase (CaM kinase) II; Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04515 calcium/calmodulin-dependent protein kinase (CaM kinase) II; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04515 calcium/calmodulin-dependent protein kinase (CaM kinase) II |
EC | 2.7.11.17 |
Transcription Factor Family | WRKY |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826541 |
Trichome-related Gene from Literature | N/A |