| Detail of EST/Unigene BE319302 |
| Acc. | BE319302 |
| Internal Acc. | NF016A05RT1F1036 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Calcium-dependent protein kinase SK5 OS=Glycine max E-value=4e-82; Calcium-dependent protein kinase 4 OS=Arabidopsis thaliana E-value=1e-68; Calcium-dependent protein kinase 11 OS=Arabidopsis thaliana E-value=2e-68; Calcium-dependent protein kinase 12 OS=Arabidopsis thaliana E-value=2e-67; Calcium-dependent protein kinase 2 OS=Arabidopsis thaliana E-value=2e-62; |
| Length | 546 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DROOT; |
| Sequence | CGGAGGTCTTGCGCAAACTCTATGGACCTGAATCAGATGTGTGGAGTGCTGGAGTTATTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04020 Calcium signaling pathway > K04515 calcium/calmodulin-dependent protein kinase (CaM kinase) II; Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04515 calcium/calmodulin-dependent protein kinase (CaM kinase) II; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04515 calcium/calmodulin-dependent protein kinase (CaM kinase) II |
| EC | 2.7.11.17 |
| Transcription Factor Family | WRKY |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 826541 |
| Trichome-related Gene from Literature | N/A |