Detail of EST/Unigene BE319320 |
Acc. | BE319320 |
Internal Acc. | NF019E09RT1F1067 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | (3S,6E)-nerolidol synthase 1 OS=Fragaria ananassa E-value=8e-08; (3S,6E)-nerolidol synthase 1, chloroplastic OS=Fragaria vesca E-value=1e-07; (3S,6E)-nerolidol synthase 2, chloroplastic/mitochondrial OS=Fragaria ananassa E-value=5e-07; |
Length | 362 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DROOT; |
Sequence | GGACCAACTTACAATACTCACAGACGCTGTTAACAGGTATTCAATTTTAAATAAATTTAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |