| Detail of EST/Unigene BE319320 |
| Acc. | BE319320 |
| Internal Acc. | NF019E09RT1F1067 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | (3S,6E)-nerolidol synthase 1 OS=Fragaria ananassa E-value=8e-08; (3S,6E)-nerolidol synthase 1, chloroplastic OS=Fragaria vesca E-value=1e-07; (3S,6E)-nerolidol synthase 2, chloroplastic/mitochondrial OS=Fragaria ananassa E-value=5e-07; |
| Length | 362 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DROOT; |
| Sequence | GGACCAACTTACAATACTCACAGACGCTGTTAACAGGTATTCAATTTTAAATAAATTTAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |