| Detail of EST/Unigene BE319340 |
| Acc. | BE319340 |
| Internal Acc. | NF016B12RT1F1096 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | unknown |
| Length | 333 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DROOT; |
| Sequence | AGGAAATGATCTGTCTAGGAGTTTTAACTGGGGTGGTTCATTTCCTTTTGCTTGGAAGTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K00901 diacylglycerol kinase; Metabolism > Lipid Metabolism > ko00564 Glycerophospholipid metabolism > K00901 diacylglycerol kinase; Environmental Information Processing > Signal Transduction > ko04070 Phosphatidylinositol signaling system > K00901 diacylglycerol kinase |
| EC | 2.7.1.107 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 835876 |
| Trichome-related Gene from Literature | N/A |