| Detail of EST/Unigene BE319646 |
| Acc. | BE319646 |
| Internal Acc. | NF017B03RT1F1025 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutamine synthetase nodule isozyme OS=Medicago sativa E-value=8e-56; Glutamine synthetase root isozyme A OS=Pisum sativum E-value=9e-55; Glutamine synthetase root isozyme B OS=Pisum sativum E-value=3e-54; Glutamine synthetase PR-2 OS=Phaseolus vulgaris E-value=4e-53; Glutamine synthetase nodule isozyme OS=Vigna aconitifolia E-value=3e-51; |
| Length | 376 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DROOT; |
| Sequence | TGACCCTTCAAAACTTCCTAAATGGAACTATGATGGATCAAGCACAAATCAAGCTCCAGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01915 glutamine synthetase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01915 glutamine synthetase; Metabolism > Glycan Biosynthesis and Metabolism > ko00550 Peptidoglycan biosynthesis > K01915 glutamine synthetase; Environmental Information Processing > Signal Transduction > ko02020 Two-component system > K01915 glutamine synthetase |
| EC | 6.3.1.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 821050 |
| Trichome-related Gene from Literature | N/A |