Detail of EST/Unigene BE319697 |
Acc. | BE319697 |
Internal Acc. | NF017H10RT1F1080 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | (3S,6E)-nerolidol synthase 1 OS=Fragaria ananassa E-value=4e-22; (3S,6E)-nerolidol synthase 2, chloroplastic/mitochondrial OS=Fragaria ananassa E-value=2e-21; (3S,6E)-nerolidol synthase 1, chloroplastic OS=Fragaria vesca E-value=2e-21; S-(+)-linalool synthase, chloroplastic OS=Arabidopsis thaliana E-value=4e-17; Tricyclene synthase 1e20, chloroplastic OS=Antirrhinum majus E-value=9e-14; |
Length | 613 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DROOT; |
Sequence | CCAAGGAGGTGAAGTTTTCGGAGTATCAACCTCTGAAATGGTACACATGGCCCATGGCAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842465 |
Trichome-related Gene from Literature | N/A |