| Detail of EST/Unigene BE319710 |
| Acc. | BE319710 |
| Internal Acc. | NF020A10RT1F1069 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Zeaxanthin epoxidase, chloroplastic OS=Arabidopsis thaliana E-value=3e-28; Zeaxanthin epoxidase, chloroplastic OS=Solanum lycopersicum E-value=7e-27; Zeaxanthin epoxidase, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-26; Zeaxanthin epoxidase, chloroplastic OS=Nicotiana plumbaginifolia E-value=2e-26; Zeaxanthin epoxidase, chloroplastic OS=Prunus armeniaca E-value=3e-26; |
| Length | 539 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DROOT; |
| Sequence | GTCAATCACAAGGGTAATTCTAAACACCCTTATATGAAATCAACCAAGATCATTACTAGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 836838 |
| Trichome-related Gene from Literature | N/A |