Detail of EST/Unigene BE319710 |
Acc. | BE319710 |
Internal Acc. | NF020A10RT1F1069 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Zeaxanthin epoxidase, chloroplastic OS=Arabidopsis thaliana E-value=3e-28; Zeaxanthin epoxidase, chloroplastic OS=Solanum lycopersicum E-value=7e-27; Zeaxanthin epoxidase, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-26; Zeaxanthin epoxidase, chloroplastic OS=Nicotiana plumbaginifolia E-value=2e-26; Zeaxanthin epoxidase, chloroplastic OS=Prunus armeniaca E-value=3e-26; |
Length | 539 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DROOT; |
Sequence | GTCAATCACAAGGGTAATTCTAAACACCCTTATATGAAATCAACCAAGATCATTACTAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836838 |
Trichome-related Gene from Literature | N/A |