Detail of EST/Unigene BE319854 |
Acc. | BE319854 |
Internal Acc. | NF020E02RT1F1007 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Choline/ethanolamine kinase OS=Homo sapiens E-value=8e-14; Probable ethanolamine kinase B OS=Dictyostelium discoideum E-value=2e-13; Choline/ethanolamine kinase OS=Mus musculus E-value=5e-13; Choline kinase B1 OS=Caenorhabditis elegans E-value=6e-13; Probable ethanolamine kinase OS=Nematostella vectensis E-value=8e-13; |
Length | 393 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DROOT; |
Sequence | TAAGCTTCATATGCCTGGTACAAAGAAGGCTCACATTTGGCAGAGAATGAGGAACTGGGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00564 Glycerophospholipid metabolism > K00866 choline kinase; Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K00866 choline kinase; Metabolism > Lipid Metabolism > ko00564 Glycerophospholipid metabolism > K00894 ethanolamine kinase |
EC | 2.7.1.32 2.7.1.82 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826564 |
Trichome-related Gene from Literature | N/A |