Detail of EST/Unigene BE319971 |
Acc. | BE319971 |
Internal Acc. | NF021H12RT1F1096 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chorismate synthase 1, chloroplastic OS=Solanum lycopersicum E-value=2e-72; Chorismate synthase, chloroplastic OS=Corydalis sempervirens E-value=4e-72; Chorismate synthase, chloroplastic OS=Arabidopsis thaliana E-value=8e-72; Chorismate synthase 2, chloroplastic OS=Solanum lycopersicum E-value=1e-70; Chorismate synthase OS=Trichodesmium erythraeum (strain IMS101) E-value=3e-55; |
Length | 497 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DROOT; |
Sequence | CTTATAGGCCTTCCCATGCAGATGCAACCTATGACATGAAGTATGGTGTCAGATCAGTTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841307 |
Trichome-related Gene from Literature | N/A |