Detail of EST/Unigene BE320002 |
Acc. | BE320002 |
Internal Acc. | NF022D08RT1F1062 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Hydroxyisourate hydrolase OS=Glycine max E-value=3e-61; Beta-glucosidase 11 OS=Arabidopsis thaliana E-value=2e-42; Beta-glucosidase 31 OS=Oryza sativa subsp. japonica E-value=4e-36; Beta-glucosidase 22 OS=Oryza sativa subsp. japonica E-value=4e-36; Beta-glucosidase 3 OS=Arabidopsis thaliana E-value=4e-35; |
Length | 512 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DROOT; |
Sequence | CCAAGGGTAACTCAACATTTGAACCGTACTTGGTAGTTCATCATATTTTGCTAGCGCATT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01229 lactase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
EC | 3.2.1.108 3.2.1.21 3.2.1.62 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839435 |
Trichome-related Gene from Literature | N/A |