Detail of EST/Unigene BE320032 |
Acc. | BE320032 |
Internal Acc. | NF030B11RT1F1089 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Type I inositol 1,4,5-trisphosphate 5-phosphatase 1 OS=Arabidopsis thaliana E-value=3e-19; Type I inositol 1,4,5-trisphosphate 5-phosphatase 2 OS=Arabidopsis thaliana E-value=2e-10; Type I inositol 1,4,5-trisphosphate 5-phosphatase CVP2 OS=Arabidopsis thaliana E-value=8e-08; |
Length | 379 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DROOT; |
Sequence | CAATGAAACGACTTCTTCTCAACAGATTAGTAAGCTATCTAGAATGGTTAGTGGGACTGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843501 |
Trichome-related Gene from Literature | N/A |