Detail of EST/Unigene BE320370 |
Acc. | BE320370 |
Internal Acc. | NF030A10RT1F1069 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Aldo-keto reductase family 4 member C9 OS=Arabidopsis thaliana E-value=8e-13; Aldo-keto reductase family 4 member C11 OS=Arabidopsis thaliana E-value=2e-12; Non-functional NADPH-dependent codeinone reductase 2 OS=Papaver somniferum E-value=7e-12; Aldo-keto reductase family 4 member C10 OS=Arabidopsis thaliana E-value=7e-12; Probable NAD(P)H-dependent oxidoreductase 2 OS=Oryza sativa subsp. japonica E-value=1e-10; |
Length | 211 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DROOT; |
Sequence | TATAAGTTAGGCTTAGCAAAGTCCATTGGCATATGCAATTATGGTACCAAAAAATTGACT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00011 aldehyde reductase; Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K00011 aldehyde reductase |
EC | 1.1.1.21 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818354 |
Trichome-related Gene from Literature | N/A |