| Detail of EST/Unigene BE320576 |
| Acc. | BE320576 |
| Internal Acc. | NF034D11RT1F1090 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Trans-cinnamate 4-monooxygenase OS=Medicago sativa E-value=5e-96; Trans-cinnamate 4-monooxygenase OS=Cicer arietinum E-value=1e-90; Trans-cinnamate 4-monooxygenase OS=Pisum sativum E-value=2e-90; Trans-cinnamate 4-monooxygenase OS=Glycyrrhiza echinata E-value=4e-87; Trans-cinnamate 4-monooxygenase OS=Glycine max E-value=5e-83; |
| Length | 608 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DROOT; |
| Sequence | GATGTATAATATTATGTATAGGATTATGTTTGATAGAAGATTTGAAAGTGAAGAGGATCC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817599 |
| Trichome-related Gene from Literature | 817599 |