| Detail of EST/Unigene BE320639 |
| Acc. | BE320639 |
| Internal Acc. | NF035E09RT1F1067 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Peroxisomal acyl-coenzyme A oxidase 1 OS=Arabidopsis thaliana E-value=2e-23; Putative peroxisomal acyl-coenzyme A oxidase 1.2 OS=Arabidopsis thaliana E-value=2e-21; Peroxisomal acyl-coenzyme A oxidase 1 OS=Cavia porcellus E-value=9e-10; |
| Length | 398 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DROOT; |
| Sequence | CACAGGTTCGCCCTAATGCAATTGCGCTTGTTGATGCATTTAACTACACCGATCATCTAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00592 alpha-Linolenic acid metabolism > K00232 acyl-CoA oxidase; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K00232 acyl-CoA oxidase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K00232 acyl-CoA oxidase |
| EC | 1.3.3.6 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827381 |
| Trichome-related Gene from Literature | N/A |