Detail of EST/Unigene BE320647 |
Acc. | BE320647 |
Internal Acc. | NF035G05RT1F1036 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 71B34 OS=Arabidopsis thaliana E-value=2e-31; Cytochrome P450 71B9 OS=Arabidopsis thaliana E-value=3e-30; Cytochrome P450 71B36 OS=Arabidopsis thaliana E-value=4e-29; Cytochrome P450 71B35 OS=Arabidopsis thaliana E-value=5e-29; Cytochrome P450 71B37 OS=Arabidopsis thaliana E-value=2e-28; |
Length | 385 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DROOT; |
Sequence | CTACACCAGCTTGACCCTTCATCCCCACATCACTCCTTATGGAAACTTTCCAAACACCTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07410 cytochrome P450, family 1, subfamily B, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07410 cytochrome P450, family 1, subfamily B, polypeptide 1; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07414 cytochrome P450, family 2, subfamily D |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822234 |
Trichome-related Gene from Literature | N/A |