| Detail of EST/Unigene BE320721 |
| Acc. | BE320721 |
| Internal Acc. | NF034D01RT1F1010 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Hydroxyisourate hydrolase OS=Glycine max E-value=2e-52; Beta-glucosidase 11 OS=Arabidopsis thaliana E-value=2e-37; Beta-glucosidase 3 OS=Arabidopsis thaliana E-value=2e-36; Beta-glucosidase 4 OS=Arabidopsis thaliana E-value=1e-35; Beta-glucosidase 1 OS=Arabidopsis thaliana E-value=2e-35; |
| Length | 399 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DROOT; |
| Sequence | GGCACGAGGCCAAGGGCAACTCAACATTTGAACCGTACTTGGTAGTTCATCATATTTTGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01229 lactase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
| EC | 3.2.1.108 3.2.1.21 3.2.1.62 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839435 |
| Trichome-related Gene from Literature | N/A |