Detail of EST/Unigene BE320742 |
Acc. | BE320742 |
Internal Acc. | NF033C10RT1F1070 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Farnesyl pyrophosphate synthase 1 OS=Lupinus albus E-value=3e-49; Farnesyl pyrophosphate synthase 2 OS=Lupinus albus E-value=5e-48; Farnesyl pyrophosphate synthase 2 OS=Parthenium argentatum E-value=3e-45; Farnesyl pyrophosphate synthase OS=Artemisia annua E-value=4e-45; Farnesyl diphosphate synthase 1 OS=Artemisia spiciformis E-value=4e-45; |
Length | 305 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DROOT; |
Sequence | GAAAGCTGAACCGTGGACTGTCAGTTATTGACAGCTACCGATTGTTAAAAGAAGGACAGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00900 Terpenoid biosynthesis > K00787 dimethylallyltranstransferase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00787 dimethylallyltranstransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00900 Terpenoid biosynthesis > K00795 geranyltranstransferase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00795 geranyltranstransferase |
EC | 2.5.1.1 2.5.1.10 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 834828 |
Trichome-related Gene from Literature | N/A |