| Detail of EST/Unigene BE321093 |
| Acc. | BE321093 |
| Internal Acc. | NF021E11IN1F1083 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S12, chloroplastic OS=Vitis vinifera E-value=6e-16; 30S ribosomal protein S12, chloroplastic OS=Nicotiana tabacum E-value=6e-16; 30S ribosomal protein S12, chloroplastic OS=Spinacia oleracea E-value=6e-16; 30S ribosomal protein S12, chloroplastic OS=Solanum tuberosum E-value=6e-16; 30S ribosomal protein S12, chloroplastic OS=Solanum lycopersicum E-value=6e-16; |
| Length | 329 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | CCAGCTCATTATATATATATGACTCACCATGCCAACTATAAAACAACTTATTAGAAACAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |