Detail of EST/Unigene BE321116 |
Acc. | BE321116 |
Internal Acc. | NF020B03IN1F1025 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Malate dehydrogenase, glyoxysomal OS=Cucumis sativus E-value=4e-16; Malate dehydrogenase, glyoxysomal OS=Citrullus lanatus E-value=4e-15; Malate dehydrogenase, glyoxysomal OS=Arabidopsis thaliana E-value=4e-14; Malate dehydrogenase 2, glyoxysomal OS=Brassica napus E-value=1e-12; Malate dehydrogenase, glyoxysomal OS=Glycine max E-value=2e-12; |
Length | 176 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | GGAAGCACATGCAGGAGCCAACCAAAGGATTGCAAGAATCTCTGCTCATCTTCACCCTTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830825 |
Trichome-related Gene from Literature | N/A |